SN/T 4661-2016 in English
VALIDQuarantine protocol for Schmallenberg disease
- Issued on:2016-12-12
- Implemented on:2017-07-01
- File Format:PDF
- Delivery:Via email within 1~3 business days
$233.00
| Standard No: | SN/T 4661-2016 |
| Document status: | VALID |
| Title in English: | Quarantine protocol for Schmallenberg disease |
| Title in Chinese: | 施马伦贝格病检疫技术规范 |
| Language: | English |
| File Format: | Electronic (PDF) |
| Delivery: | Via email within 1~3 business days |
| Issued on: | 2016-12-12 |
| Implemented on: | 2017-07-01 |
| Professional Classification: | SN-Import&Export Inspection |
| Related Keywords: | schmallenberg disease introduction standard background
schmallenberg virus quarantine protocol comprehensive quarantine technology system notifiable disease |
| Related Topics: | Quarantine technology
Border disease quarantine technology Equine bubonic quarantine technology |
Introduction
Standard Background and Technological Evolution
This standard was developed in response to the Schmallenberg virus (SBV), first reported in Europe in 2011. This virus, belonging to the genus Orthobunyavirus in the family Bunyaviridae, primarily causes fever and abortion in ruminants. As the outbreak spread, the OIE designated it a notifiable disease, and this standard establishes a comprehensive quarantine technology system.
Comparison of core detection methods
| Method | Sensitivity | Specificity | Time Consumption | Applicable samples |
|---|---|---|---|---|
| Real-time RT-PCR | 103 copies/μL | 100% | 2 hours | Whole blood, tissue, semen |
| Blocking ELISA | 1:32000 dilution | 98.7% | 4 hours | Serum, plasma |
Key Technical Points
Real-time Fluorescence RT-PCR
Using the AgPath-ID™ One-Step RT-PCR Kit, primer sequences:
Forward: TCAGATTGTCATGCCCCTTG
Reverse: TTCGGCCCCAGGTGCAAATC
Probe: FAM-TTAAGGGATGCACCTGGGCCGATGGT-BHQ1
Blocking ELISA
Key Parameters:
- Coating Antigen Concentration: 2μg/mL
- Positive Determination: PI≥50%
- Negative Determination: PI≤40%
Implementation Suggestions
- Samples must be transported in a cold chain maintained at 2-8℃ to avoid repeated freezing and thawing.
- Laboratories should operate in separate areas, and PCR product processing should comply with the requirements of GB 19489.
- It is recommended to use two methods in parallel to improve the detection rate.
Typical Application Case
During the 2014 Zambia epidemic, this standard was used to test bovine serum samples. A positive case with a Ct value of 28.3 was detected by RT-PCR, and sequencing confirmed that the homology with the European strain was 99.2%.
Loading PDF document...
Error loading PDF. Please make sure the file is valid and try again.
We also recommend
-
SN/T 0244-1994 in English
\"General Rules for Inspection and Certification of Imported Mechanical and Electrical Instruments\"
1993-08-01 -
SN/T 1401-2011 in English
Detection and Identification of Mango Weevil
2011-02-25 -
SN 0283-1994 in English
\"Method for Inspection of Dichlorodipyridinol Residues in Exported Poultry Meat\"
1994-02-18 -
SN/T 0669-2011 in English
Determination of Gentamycin Residues in Meats and Meat Products for Export - Cylinder Plate Method
2011-02-25 -
SN/T 4968.4-2017 in English
Identification of common rodents -Part 4: Mus musculus
2017-11-07 -
SN/T 3971-2014 in English
Immunochromatographic assay of colloidal gold for detection of pests des petits ruminants
2014-07-14 -
SN 0521-1996 in English
Method for the determination of daminozide residues in oil seeds for export - Spectrophotometric method
1996-04-29 -
SN/T 4453-2016 in English
Molecular typing method of Staphylococcus aureus in export food-SPA typing method
2016-03-09 -
SN/T 5483.4-2022 in English
Protocol for assessing animal health status of exporting countryPart 4 :Bovine spongiform encephalopathy
2022-07-07 -
SN/T 4902-2017 in English
Determination of phthalate esters in cosmetics for import and export—GC-MS method
2017-08-29
