SN/T 5108-2019 in English
VALIDDetection of rotavirus，astrovirus，norovirus and sa povirus byquadriplex HRMA at frontier ports
- Issued on:2019-09-03
- Implemented on:2020-03-01
- File Format:PDF
- Delivery:Via email within 1~3 business days
$88.00
Introduction
Analysis of the core content of the standard
| Virus type | Genome characteristics | Detection fragment (bp) | Melting temperature (℃) |
|---|---|---|---|
| Rotavirus | 11 segments of double-stranded RNA | 82-102 | 78.5±0.3 |
| Norovirus | single-stranded RNA(7.6kb) | 89-112 | 81.2±0.4 |
| Astrovirus | single-stranded RNA(6.8kb) | 76-98 | 75.8±0.5 |
| Zahravirus | single-stranded RNA(7.5kb) | 85-107 | 79.6±0.6 |
In-depth analysis of the technical principles
HRMA technology uses EvaGreen fluorescent dye to perform closed-tube detection of PCR products through melting curve analysis with a 0.01℃ resolution. The quadruple detection system adopts:
- Common primer 5' end GGGGTCCCAAAAGGGTCAGT universal sequence
- Virus-specific 3' end degenerate primer design
- Single tube simultaneous detection of four viral nucleic acids
Key points for implementation of the standard
Biosafety requirements
According to GB19489, experimental operations must be carried out in a Class II biosafety cabinet, and sample pretreatment requires centrifugation at 8000rpm before taking the supernatant.
Key Quality Control Nodes
- In vitro transcribed RNA standard control must be set
- Melting temperature deviation must be ≤0.5℃
- The negative control curve should be a baseline straight line
Technical Advantages Analysis
Compared with traditional methods, HRMA technology has the following advantages:
- Detection cost is reduced by 40% (no probe required)
- Detection cycle is shortened to 2 hours
- Contamination risk is reduced (closed tube operation)
Standard Application Recommendations
Recommendations for laboratories:
- Regularly verify the temperature calibration of the Rotor-Gene Q instrument
- Establish a local virus strain melting curve database
- Each batch of testing includes 2 positive controls
Loading PDF document...
Error loading PDF. Please make sure the file is valid and try again.
We also recommend
-
SN 0283-1994 in English
\"Method for Inspection of Dichlorodipyridinol Residues in Exported Poultry Meat\"
1994-02-18 -
SN/T 3382-2012 in English
Determination of non-protein-nitrogen content in milk and dairy products for export
2012-12-12 -
SN/T 3851-2014 in English
Determination of phospholipid in food for export - Colorimetric method
2014-01-13 -
SN/T 2491-2010 in English
Quality evaluation standard for import and export liquefied natural gas
2010-03-02 -
SN/T 5642.2-2023 in English
Detection of lactic acid bacteria in dairy products for exportEnumeration method of digital PCRPart 2: Bifidobacterium bifidum
2023-11-01
